DNA sequence visualization

While reading this very interesting article about history of human genome I stumbled upon a fact that we have portion of our DNA that is 3 billion years old !! That's pretty damn a big number of years for some DNA sequence to survive in between of trillions of our ancestors. That's get my attention and I wanted to see how this 3 billion year sequence looks like in visualized form. But after a short google search I didn't found a simple DNA sequence visualizer. So I've decided to code that simple DNA sequence visualizer in browser with the help of javascript. So here it is:
(by default this 3 billion years old DNA sequence shared among all living creatures is set, but you can paste your own sequence as well - hit the button to see it).

Your browser does not support the HTML5 canvas tag.

GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAG

Each nucleobase in different color

So better check if your friend has this 3 billion year sequence - otherwise you may be talking with Cylon =)